Follow

Configure POP3 Account on iPhone

You may want to read email on your iPhone for your basic Exchange mailbox at some point in time. Use these instructions to set up the account. This will allow you access to only your email... not contacts and calendar.

1. Open Settings
2. Open Mail, Contacts, Calendars
3. Select Add Account...
4. Select Other.
5. Select Add Mail Account
6. Enter your Name
7. Enter your email Address
8. Enter your Password
9. Enter a Description (mailhost123)
10. Click Next.
11. Select POP
12. Scroll to Incoming Mail Server.
a. Host Name: pop.mailhost123.com
b. User Name: your email address
c. Password: your password
13. Scroll to Outgoing Mail Sever.
a. Host Name: smtp.mailhost123.com
b. User Name: your email address
c. Password: your password
14. Click Save.
15. You may see a popup asking if you would like to setup the account without SSL. Select Yes. It may pop up a second time. Again select Yes.
16. It may take some time but the account should finally verify.

Once the account is verified you can view emails through the Mail icon and selecting the mailhost123 account.

Please see below for a more visual guide to creating the account on your iPhone.

Open Settings

?name=IMG_0208_1_.png

 

Open Mail, Contacts, Calendars

?name=Open_Mail__Contacts__Calendars.png

 

Select Add Account

?name=Select_Add_Account.png

 

Select Other

?name=Select_Other.png

 

Select Add Mail Account

?name=Select_Add_Mail_Account.png

 

Enter Account Details

?name=Enter_Account_Details.png

Name: your name
Address: your email address
Password: your email password
Description: mailhost123

Account Mail Server Details

?name=Account_Mail_Server_Details.png

Enter the following information.

Incoming Mail Server.
a. Host Name: pop.mailhost123.com
b. User Name: your email address
c. Password: your password

Outgoing Mail Sever.
a. Host Name: smtp.mailhost123.com
b. User Name: your email address
c. Password: your password

Click Save.

Verifying Account

?name=Verifying_Account.png

You will see the above message. Select Yes. This message may appear several times. It may take a few minutes but the account will verify and be added to the phone.

At this point you may open the account from the Mail icon on the iPhone.

Was this article helpful?
0 out of 0 found this helpful
Have more questions? Submit a request

1 Comments

  • 0
    Avatar
    Tino559

    Legal status: Anabolic steroids are Class C drugs which must only be sold by pharmacists with a doctor's prescription. It is therefore legal to possess steroids as long as they're in the form of a medicinal product for personal use. However possessing or possessing them with intent to supply is illegal and could lead to 14 years in prison and an unlimited fine, https://aleksi7986.soup.io/. What do steroids do to you? How it can make you feel: They main effects of anabolic steroids are that they may enable people to play sports or do exercise for longer or better, help to build up muscle tone and allow a quicker recovery after exercise. Despite successful detection and convictions by sporting anti-doping agencies, they are still being used to increase physical performance and improve appearance. The adverse side effects and potential dangers of AAS use are well documented. Recent epidemiological research has identified that the designer drugs growth hormone (GH) and insulin are also being used because of the belief that they improve sporting performance, https://jaakkima1852.soup.io/. This chapter summarizes the classification of AASs, GH, and insulin as. Anabolic-androgenic steroids (AASs) can be used to increase muscle mass and strength in adult males. Observational studies have reported that low serum testosterone is associated with lower bone mineral density and increased fracture risk in postmenopausal women, https://pauli6841.soup.io/. Testosterone is a vasodilator. Effects of testosterone treatment on sexual parameters The use of testosterone therapy for women is not based on an established link between symptoms and biochemistry, but rather on clinical evidence that exogenous testosterone improves commonly reported sexual problems, such as diminished sexual desire and arousal, pleasure, and overall satisfaction. For most women, these problems are part of a continuum of the sexual experience and are inextricably related. Recent studies evaluating the efficacy of testosterone for the treatment of female sexual dysfunction (FSD) have required participants to fulfill the diagnostic criteria for hypoactive sexual desire disorder (HSDD), defined as “persistent or recurrent deficiency or absence of sexual thoughts and fantasies and/or desire for, or receptivity for, sexual activity causing personal distress or interpersonal difficulties. The mixture was incubated at 65C for 10min and immediately cooled on ice, https://antti9470.soup.io/. Then, 20U (40U/ L) of dNTP mix, MgCl 2 to 3mM, 20U (40U/ L) of Protector RNase inhibitor, and 10U of Transcriptor Reverse Transcriptase were added to the incubated mixture to make a total volume of 20 L. Every round of cDNA synthesis was completed by incubation at 60C for 30min. Oligonucleotide Primers The sequences used were derived from the following genes: MGF (forward: GCATTGTGGATGAGTGTTGC reverse: CTTTTCTTGTGTGTCGATAGG) rat MyoD (forward: GGAGACAATCCTCAAGCGATGC reverse: AGCACCTGGTAAATCGGATTGG) rat myogenin (forward: ACTACCCACCGTCCATTCAC reverse: TCGGGGCACTCACTGTCTCT) rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward: TGGTGAAGGTCGGTGTGAAC reverse: AGGGGTCGTTGATGGCAACA). Analysis by Quantitative Real-Time Polymerase Chain Reaction (RT-qPCR) The polymerase chain reaction (PCR) procedure was performed using a Light Cycler (Roche Diagnostics, Indianapolis, IN, USA) thermalcycler with the following protocol: 5min at 95C, followed by 45 cycles of 10s at 94C, 5s at 58C, and 10s at 72C. The first reason is that a good idea. The bad news about such online suppliers is most of them. You can do it, https://tauno4969.soup.io/. It is very good. Mail order Anabolic Steroids from Roidhouse Buy Steroids you want online shopping?

Please sign in to leave a comment.
Powered by Zendesk